Below is a segment of bacterial Lac Operon sequence. An E. coli transcript with the first 5 nucleotides 5′ AUGU3′. Carefully examine the sequence and then answer the questions.
Strand A: 5’GCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAAGTTAATCACACAGGAAACAGCTATGACCATGATT 3′
Strand B: 3’CGAAATGTGAAATACGAAGGCCGAGCATACAACACACCTTAACACTCGCCTATTCAATTAGTGTGTCCTTTGTCGATACTGGTACTAA 5′
A. Where is the trascription start site?
B. find TTTACA around -35 region and box it. (my answer is highlighted in yellow above)
C. find TATGTT around -10 region and box it. (my answer highlighted pink above)
D. lable template and coding strands (my answer: template is strand B and coding is strand A)
E. does transcription elongation proceed towards the right or left? (my answer: right)
F. write the sequence of the primary RNA transcript starting at 5′ aUUGU3′. include polarity of the transcript.
Economic Debate- Progressive Income Tax For this Economic Debate, we are going to discuss the…
TOPIC: Going Global Discussion Thread 1 (initial post due Wednesday for full credit) Please note:…
Assignment Topic This week will culminate in the creation of a narrated PowerPoint to create…
The Assignment must be submitted on Blackboard (WORD format only) via allocated folder. Assignments submitted…
you need to post your 2-page information flier to share with your Final Project Group.…
discussion: Discuss the methods used at your company to measure and ensure quality products and…