Write the sequence of the primary rna transcript | Homework Help

Below is a segment of bacterial Lac Operon sequence. An E. coli transcript with the first 5 nucleotides 5′ AUGU3′. Carefully examine the sequence and then answer the questions.
Strand A: 5’GCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAAGTTAATCACACAGGAAACAGCTATGACCATGATT 3′
Strand B: 3’CGAAATGTGAAATACGAAGGCCGAGCATACAACACACCTTAACACTCGCCTATTCAATTAGTGTGTCCTTTGTCGATACTGGTACTAA 5′
A. Where is the trascription start site?
B. find TTTACA around -35 region and box it. (my answer is highlighted in yellow above)
C. find TATGTT around -10 region and box it. (my answer highlighted pink above)
D. lable template and coding strands (my answer: template is strand B and coding is strand A)
E. does transcription elongation proceed towards the right or left? (my answer: right)
F. write the sequence of the primary RNA transcript starting at 5′ aUUGU3′. include polarity of the transcript.

Don't use plagiarized sources. Get Your Custom Essay on
Write the sequence of the primary rna transcript | Homework Help
For $10/Page 0nly
Order Essay
admin

Recent Posts

Economic Debate #3- Progressive Income Tax – The Homework Helper

Economic Debate- Progressive Income Tax For this Economic Debate, we are going to discuss the…

2 years ago

MKT 6120 – Marketing Management – Davis Learning Engagement #7

TOPIC: Going Global Discussion Thread 1 (initial post due Wednesday for full credit) Please note:…

4 years ago

jvjvjhvjhvhjvj

Assignment Topic This week will culminate in the creation of a narrated PowerPoint to create…

4 years ago

Students are supposed to select a technological organization of their choice.

The Assignment must be submitted on Blackboard (WORD format only) via allocated folder. Assignments submitted…

4 years ago

Increases the risk of wildfires

you need to post your 2-page information flier to share with your Final Project Group.…

4 years ago

Statistics for Technology management

discussion: Discuss the methods used at your company to measure and ensure quality products and…

4 years ago