Write the sequence of the primary rna transcript | Homework Help
Below is a segment of bacterial Lac Operon sequence. An E. coli transcript with the first 5 nucleotides 5′ AUGU3′. Carefully examine the sequence and then answer the questions.
Strand A: 5’GCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAAGTTAATCACACAGGAAACAGCTATGACCATGATT 3′
Strand B: 3’CGAAATGTGAAATACGAAGGCCGAGCATACAACACACCTTAACACTCGCCTATTCAATTAGTGTGTCCTTTGTCGATACTGGTACTAA 5′
A. Where is the trascription start site?
B. find TTTACA around -35 region and box it. (my answer is highlighted in yellow above)
C. find TATGTT around -10 region and box it. (my answer highlighted pink above)
D. lable template and coding strands (my answer: template is strand B and coding is strand A)
E. does transcription elongation proceed towards the right or left? (my answer: right)
F. write the sequence of the primary RNA transcript starting at 5′ aUUGU3′. include polarity of the transcript.
We've got everything to become your favourite writing service
Money back guarantee
Your money is safe. Even if we fail to satisfy your expectations, you can always request a refund and get your money back.
Confidentiality
We don’t share your private information with anyone. What happens on our website stays on our website.
Our service is legit
We provide you with a sample paper on the topic you need, and this kind of academic assistance is perfectly legitimate.
Get a plagiarism-free paper
We check every paper with our plagiarism-detection software, so you get a unique paper written for your particular purposes.
We can help with urgent tasks
Need a paper tomorrow? We can write it even while you’re sleeping. Place an order now and get your paper in 8 hours.
Pay a fair price
Our prices depend on urgency. If you want a cheap essay, place your order in advance. Our prices start from $11 per page.