Nutrient Assimilation and Adaptations Assignment | Online Homework Help

You will be doing plant number 4 for the nutritional adaptations assignment. The comprehensive guide is attached, and is atached.

BIOSCI 500 PLANT PHYSIOLOGY –  Spring 2020

Nutrient Assimilation and Adaptations Assignment

 

Objective: to use BLAST and other online, lecture and course text research to assemble information about the plant with possible symbionts based on which genes are present, and present a summary of the gene names, protein functions, and place in nutrient assimilation and plant adaptations.

 

Main tools:

• NCBI BLAST search – Basic Local Alignment Search Tool. Finds regions of biological sequence similarity; compares nucleotide or amino acid sequences to sequences in databases and calculates statistical significance https://blast.ncbi.nlm.nih.gov/Blast.cgi – choose NUCLEOTIDE BLAST nucleotide>nucleotide
• google search – use to find definitions of terms, genes, proteins and where they are found, what they do, more about the plant species names you encounter and links to scientific articles
• Plant Physiology Textbook – Taiz et al. 2018 or similar
• Web of Science – for additional scientific articles if needed

 

1. For each plant listed in the emailed list, mRNA has been isolated from plant tissues, and sequenced, and some of the sequences found (converted to DNA (AGTC) sequence) are listed.
2. You need to do a BLAST search of each of the 7 sequences for your plant, identify the gene name, function and likely location in the plant (and any special details) for each gene.
3. Collect this information for each plant and then answer the questions about what nutritional adaptations the plant has evolved to aid nutrient acquisition and assimilation.
4. Most of you have done this before in class in the exercise on photosynthesis genes. If you missed that class and need help, let me know, but all the instructions should be below.

 

Some important definitions: fasta is a text based format for representing either nucleotide sequences or peptide sequences, in which nucleotides or amino acids are represented using single-letter codes. The format also allows for sequence names and comments to precede the sequences.  BLAST uses fasta formatting and recognizes > at the beginning of a sequence. Fasta used from many bioinformatics application (including mass sequencing)

 

>Test 1 sequence

AGTGTTGGATTCAAAGCTGGTGTTAAAGAGTATAAATTGACTTATTATACTCCTGAATATGAAACCAAGG

ATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAGCAGGGGCTGC

GGTAGCTGCTGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGGCTTACCAGCCTTGATCGT

TACAAAGGACGATGCTACCTGGGCGAGCCAGTTCCAGGAGAAGAAACTCAATTTATT

 

Go to https://blast.ncbi.nlm.nih.gov/Blast.cgi   scroll down and choose NUCLEOTIDE BLAST nucleotide>nucleotide  and cut and paste the sequence above INCLUDING the >and name at the top, into the ‘enter query sequence’ box.

Then leaving all defaults alone, scroll down and click                              and then wait until the search is

 

complete (a few seconds – minute). Then scroll down and look at the output. The top one or two ‘hits’ are probably what you are looking for. With the >test 1 sequence above, you should see Arabidopsis Ribulose 1,5-bisphosphate carboxylase/oxygenase Rubisco rbcL gene at the top.

 

 

Alignment results outputs:

E value (very low is highly similar; 0.0 is essentially identical) % identity is how much is identical. Most of your data will be virtually identical to sequences in the database so will have very low E numbers. Scroll down to find the gene identities to find out what the gene you have does. Avoid complete genome, chloroplast genome options, chromosome or genomic scaffold which indicate whole genome sequencing fragments with many genes on them (increasingly common) and keep scrolling down until you find an actual gene name. For these genes, they will mostly be the first or second ‘hit’.

Record the Genus/species information, and any information about what the gene name is and what it encodes for. You can click the link and see more gene alignment details, and the ‘sequence ID’. Click this and it will get you to a page with more information about the gene, the organism and other links including scientific papers on this gene and plant or other organism. If you need to find out about these, you can google search those terms.

 

What you need to do to complete for this assignment:

 

For your plant, you need to complete the BLAST searches to identify genes, and carry out follow-up research to determine the context of those genes in nutrient assimilation, adaptations and symbioses.

1. I will email you separately a set of fasta sequences which you should use for your assignment, specific to your plant
2. You may use email or discussion on Canvas to get help with details for your plant from other students who also have your plant, but all students should carry out all the searches, and submit a unique, completed assignment (if more than one student has identical text or diagram, both will get zero for that part).
3. You need to fill out the tables for your plant and answer a series of questions in the worksheet below. The more detail you supply the better!
4. You need to include at least one full citation for a scientific paper related to the plant or symbiosis. Use the following citation format (do not include hyperlinks)

Young EB, Grothjan JJ, 2019. Pitcher plant enzyme analysis. Journal of Carnivorous Plants 45: 20-29.

5. You need to complete the grading rubric and checklist table at the end of the worksheet
6. Using a template, you will also complete a diagram of cells in the plant symbiosis you discover illustrating the pathways for nutrient assimilation, and where the proteins you identify fit in the cells of your diagrams.
7. Check that you haven’t plagiarized by copying and pasting any text from a paper, website, Discussion post or other (see end of grading rubric!)
8. Upload the word document worksheet (see below) with the tables and questions to Canvas, and upload a picture (as a jpg or pdf) of your diagram (or include diagram in your word document). All these items are due 22 April to Canvas.

 

EXAMPLE OF SEARCH OF GENE AND THE INFORMATION YOU SHOULD INPUT INTO THE WORKSHEET FOR EACH GENE, using the test gene from above

Worksheet questions shown in yellow

With the >test 1 sequence above, you should see Arabidopsis Ribulose 1,5-bisphosphate carboxylase/oxygenase Rubisco rbcL gene at the top.

 

What plant do you think this is? Include Genus, species and any major useful taxonomic information (e.g. some groups of plants are known for particular nutrient adaptations):

The plant is Arabidopsis thaliana (thale cress) which is a model plant species in the family Brassicaceae

 

What genes did you find and why do you think they might be present? How might the genes and the proteins they encode be involved in nutrient uptake or assimilation? Did you find genes involved in nitrogen uptake and assimilation?

 

Type the information into the table below, using as much space as you need.

 

Gene	Gene name	Protein/enzyme name	Functions in nutrient assimilation and/or symbiosis
1	rbcL	Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) Large subunit of multi-unit protein complex. Encoded on chloroplast genome	The enzyme is the primary step in CO2 fixation in all plants, within the Calvin cycle. Supports fixation of inorganic atmospheric CO2 into organic molecules (supports all food chains!)

 

Was there evidence for any other organisms and what do you think they are doing? Include a name but also what type of organism (e.g. bacteria, cyanobacteria, fungi…?)

No evidence for this gene (others will have some evidence)

 

What tissue/s, cells and/or organelles in the plant or other organism would you expect these mRNA were isolated from?

mRNA)	Probably or possible location/s
rbcL	Encoded on plastid genome and protein is active in chloroplast stroma so the mRNA is likely isolated from chloroplast in leaf cells which are actively involved in photosynthesis

 

Include the citation for a scientific article related to this plant and at least one of the genes identified:

Whitney SM, Birch R, Kelso C, Beck JL, Kapralove MV. 2015. Improving recombinant Rubisco biogenesis, plant photosynthesis and growth by coexpressing its ancillary RAF1 chaperone. Proc. Natl. Acad. Sci USA 112: 3564-3569

 

Is there any other cool stuff you found out about the plant or the genes?  Is there any evidence for other metabolic processes or associations?

The rbcL unit is encoded on chloroplast genome, but the other part of the protein, the small subunit, is encoded by the rbcS gene which is encoded on the nuclear genome! With more than one gene, metabolic processes or associations may be more obvious!

Here to the right is a basic diagram which incorporates the rbcL gene in Rubisco. Yours will have more than one gene so will be more complex and have more details!

 

 

BIOSCI 500 PLANT PHYSIOLOGY –  Spring 2020

Nutrient Assimilation and Adaptations Assignment    Report Worksheet              

 

Fill in the details and answer questions below (also see grading rubric at the bottom)

Your name:                                                                                       Plant Number:

 

What plant do you think this is? Include Genus, species and any major useful taxonomic information (e.g. some groups of plants are known for particular nutrient adaptations):

 

 

What genes did you find and why do you think they might be present? How might the genes and the proteins they encode be involved in nutrient uptake or assimilation? Did you find genes involved in nitrogen uptake and assimilation?

 

Type the information into the table below, using as much space as you need.

 

Gene	Gene name	Protein/enzyme name	Functions in nutrient assimilation and/or symbiosis
1
2
3
4
5
6
7
8

 

 

Was there evidence for any other organisms and what do you think they are doing? Include a name but also what type of organism (e.g. bacteria, cyanobacteria, fungi…?)

 

 

 

What tissue/s, cells and/or organelles in the plant or other organism would you expect these mRNA were isolated from?

 

mRNA (Gene name from above)	Probably or possible location/s

 

 

Include the citation for a scientific article related to this plant and at least one of the genes identified:

 

 

Is there any other cool stuff you found out about the plant or the genes?  Is there any evidence for other metabolic processes or associations?

 

 

 

Using something like the template below, draw a diagram of a cell of this plant and any symbiotic organism, and include any assimilation pathways you can illustrate. You can draw freehand with clear labels or construct in powerpoint or other graphics package – I am not grading drawing skills, but the information you can synthesize and convey. Show transfer of things as arrows, show enzymes in circles or similar. Indicate where transmembrane transport might need a transporter… and indicate where in the cells the proteins encoded by the genes above would be located.

(see the slides on N assimilation in lecture 14 as an example)

 

 

 

BIOSCI 500 PLANT PHYSIOLOGY –  Spring 2020

Nutrient Assimilation and Adaptations Assignment  –  Report Grading Rubric and Checklist

 

Essential component	How well do you think you have done this? Out of score to right	Maximum score
Your name and plant number on the file above and the second column of this table has been filled in		3
Has the plant genus and/or species been correctly identified along with some taxonomic information		5
Has each gene been identified with a Genus species name and a gene name? (2 pt per gene)		14
Has each gene been identified as encoding a protein and/or enzyme name? (1 pt per gene)		7
Have the functions of all gene been included and the role and significance of the gene in nutrient uptake or assimilation and/or symbiosis been briefly explained? (3 pt per gene)		28
Have any other organisms (symbionts) been correctly identified with details of what type of organisms they are?		4
Have the likely tissues and/or cell organelle locations for each gene been correctly identified? (1 pt per gene)		7
Has at least one scientific article related to the genes+plant+symbiosis been cited?		4
Has the correct citation format been used?		3
Has any additional information about the plant-symbiosis been included?		3
Diagram included (uploaded in the document, or separately)		3
Clarity of diagram		4
Have cell organelles and any symbiont been included clearly and accurately on diagram?		3
Have correct pathways of uptake and assimilation been shown clearly on diagram? Has transmembrane transport been indicated on diagram?		5
Are proteins encoded by genes identified in BLAST been shown accurately in plant and symbiont cells (1 pt per gene)		7
Total points possible		100
Evidence for plagiarism from any source. Confirm to the right that you have not plagiarized any source!		minus 50
Bonus for really cool stuff reported		5

 

BIOSCI 500 PLANT PHYSIOLOGY –  Spring 2020

Nutrient Assimilation and Adaptations Assignment

 

Plant 4 – fasta sequences for cutting and pasting into the ‘enter query sequence’ search box in the nucleotide BLAST on ncbi (see search instructions in the main assignment document).

Include both the >Gene1 and the next line/s of sequences below in your cut and paste.

Search each gene separately.

 

>gene1

ATGGCAGCATCTGTCGATCGCCAGTATAACCCATCAACCATAAACGGCGTCGTTCGTACACCATTCACAACTCACCA

 

>gene2 ATGGCTCAAATACTTGCACCTAACATGCAATGTCAGATGAAACTATCAAAGAGCTTGACAAACTCAATGA

>gene3

CAACAATTACACAAAGAAACAACTTCTTAGAGAGAAAAAAAAGAAACACAACAACAAGAACACCAAAACA

>gene4TCCCAAAAGTATCAGTTTTTAGAAGTTCATAAAACCCTTTTTTCTCTCTTTTCTTCCCTAAGAAAAAAGA

 

>gene5

CCTCCCCCTGTTTCTCTGATCATACAAGCTAAGGCACAATGTCATCTTCCACCCCTATAGACGCTTGCTC

>gene6

ATTACAGTTTACGATGTATTCTCCACGAAAAAAGTGTCAAATTCTATTCAATATTTCAATACTTCAACTA

TTGGGCATTTTTTTCTTTGCAAAAGGATTTTTTCCGTATAAAACCAGTTTATCAGGTTTATCAACAGTAA

 

>Gene7

AATCGACCTTTCTATTAACTATAAATATAATATATAATCAGATAATTATTTTCAAAAAAAAAAAAGAAGA