Express a protein in a prokaryotic system | Homework Help

Questions: Provide specific answers in your own words. Be as detailed and specific as possible.

1. Provide several reasons why you might choose to express a protein in a prokaryotic system.

Don't use plagiarized sources. Get Your Custom Essay on
Express a protein in a prokaryotic system | Homework Help
For $10/Page 0nly
Order Essay

2. Provide several reasons why you might choose to express a protein in a eukaryotic system.

3. The PCR that your labmate designed is resulting in virtually no amplification. Her amplification conditions look OK, so you suspect there might be a problem with the design of her primers. What seems to be the source of the issue with her PCR? If possible, also include a diagram illustrating your answer. (Hand-drawn is OK if you are unable to generate a computerized

imageForward Primer:                             Reverse Primer:
5′- TGGACCTGGCAATACTCAGG -3′   5′- ACTCCTAGCAACGGTGAACT -3′

4. Your labmate had his headphones in and was jamming out to 1989, Taylor Swift’s latest album, so he wasn’t really paying attention when he set up his electrophoresis gel. You walked into the room just as he turned on the power button. What’s wrong with the setup he used? What will happen if the gel is allowed to run? Why? (Hint: You only have about 2 minutes to correct his mistake before it’s too late and he’ll have to start all over again!)

Adapted from: Campbell, M., & Farrell, S. (2012). Biochemistry (7th ed.). Belmont, CA: Brooks/Cole, Cengage Learning.

5. You have received a sample of a new pathogen with a 10 kb genome. In order to obtain preliminary information on its genome organization, you perform restriction enzyme digestion using HindIII and Sau3AI individually as well as in combination. Provide an explanation describing and/or diagram showing the location of the HindIII and Sau3AI cut sites within the genome. (Note that one band in the double digest is twice as bright as all the other bands

6. The use of synthetic biology to develop molecular logic gates has allowed the design of complex synthetic genetic pathways with myriad combinations and applications possible. Now organisms can be engineered to perform genetic “calculations” and respond in specific ways under specific predetermined conditions.

a) The results from logic gates can be represented in what is known as a “truth table”. The two input conditions are listed (0 = off; 1 = on), along with the output condition. For a molecular AND gate, fill in the output condition in the truth table below.

 

A

B

Output

0

0

?

0

1

?

1

0

?

1

1

?

b) Just like a molecular AND gate produces its output when both input A and B are present, a molecular OR gate produces its output when either input A or B are present:

A

B

Output

0

0

0

0

1

1

1

0

1

1

1

1

With that knowledge, examine the composite logic gate below, which is made up of an AND gate and an OR gate, the outputs of which each feed into another AND gate.

If the inputs for the initial gates are controlled by the inducing chemicals A, B, C, and D (absence of the chemical = 0; presence of the chemical = 1), construct a truth table for the composite logic gate. (Hint: there are 16 possible input combinations.)

admin

Recent Posts

Economic Debate #3- Progressive Income Tax – The Homework Helper

Economic Debate- Progressive Income Tax For this Economic Debate, we are going to discuss the…

2 years ago

MKT 6120 – Marketing Management – Davis Learning Engagement #7

TOPIC: Going Global Discussion Thread 1 (initial post due Wednesday for full credit) Please note:…

3 years ago

jvjvjhvjhvhjvj

Assignment Topic This week will culminate in the creation of a narrated PowerPoint to create…

3 years ago

Students are supposed to select a technological organization of their choice.

The Assignment must be submitted on Blackboard (WORD format only) via allocated folder. Assignments submitted…

3 years ago

Increases the risk of wildfires

you need to post your 2-page information flier to share with your Final Project Group.…

3 years ago

Statistics for Technology management

discussion: Discuss the methods used at your company to measure and ensure quality products and…

3 years ago