Genomic Analyses of DNA Transformation Journal Article Term Paper What should your term paper include? The paper should be a summary of what you present.

Genomic Analyses of DNA Transformation Journal Article Term Paper What should your term paper include?

The paper should be a summary of what you present. Your paper should be done on an individual basis and should include your interpretation of the information.

Present proper background.

Discuss all the experiments in the research paper.

Discuss the significance of the research. Comment on whether the results of the experiments used in the research paper support the conclusions made.

What is the length of your term paper?

The paper should be 5-6 pages double-spaced. Included in the five pages should be figures (more than one if you wish). However, figures should not add up to more than one of the five pages. In addition to the five pages, you should have a page that lists the references you used to write your paper. (The reference page is not included in your five pages). References can follow any scientific format you wish. !

You are NOT allowed to use quotes in your paper. The paper should be written in your own words.

He wanted us to choose a topic that was taught over the course this semester. We chose Micro-evolution.

Antibiotic Resistance is an example of micro evolution. Then we had to chose a research article on this. So briefly write how and why microevolution fits into this article. Then continue with what the term paper should include (above). Genomic Analyses of DNA Transformation and Penicillin Resistance
in Streptococcus pneumoniae Clinical Isolates
Fereshteh Fani,a Philippe Leprohon,a George G. Zhanel,b Michel G. Bergeron,a Marc Ouellettea
Centre de Recherche en Infectiologie du Centre de Recherche du CHUL and Département de Microbiologie, Infectiologie et Immunologie, Faculté de Médecine,
Université Laval, Québec, Canadaa; Department of Medical Microbiology, Faculty of Medicine, University of Manitoba, Winnipeg, Manitoba, Canadab
S
treptococcus pneumoniae is a Gram-positive pathogen that is
responsible for serious diseases like pneumonia, meningitis,
acute otitis media, and sepsis. Penicillin, a ?-lactam antibiotic, has
long been the mainstay against pneumococcal infections, but its
efficacy is threatened by the rapid dissemination of penicillinnonsusceptible clones worldwide. Resistance to ?-lactam antibiotics in clinical isolates of S. pneumoniae is mediated by mosaic
genes encoding altered penicillin-binding proteins (PBPs; a family
of enzymes involved in peptidoglycan metabolism) with lower
antibiotic binding affinities than their native versions (1, 2). While
S. pneumoniae contains six PBPs, variants of PBP2x, PBP2b, and
PBP1a are considered the most relevant for resistance, and the
acquisition of low-affinity PBP2x and PBP2b variants is a necessary first step for the acquisition of PBP1a variants that confer
high-level resistance to ?-lactams (3, 4). A role in ?-lactam resistance has also been described for other PBPs (5–8). Pneumococci
have a dedicated system for the acquisition of exogenous DNA
from the environment, and the mosaic gene structure of lowaffinity PBPs is the result of interspecies gene transfer events involving closely related streptococcal species (1, 9). Nonetheless,
the various degrees of resistance observed among nonsusceptible
clinical isolates suggest that resistance involves other complex and
multifactorial processes, and the presence of other, non-PBP contributors has indeed been reported. For example, the cell wall of
penicillin-nonsusceptible isolates is often highly enriched in
branched-chain muropeptides, a phenomenon that has been
linked to mosaic alleles of the murM gene (10, 11). Furthermore,
mutations in a peptidoglycan N-acetylglucosamine (GlcNAc)
deacetylase (12), a peptidoglycan O-acetyltransferase (13), a putative glycosyltransferase (14), a serine threonine kinase (15), a
histidine protein kinase that is part of a two-component signaltransducing system (16), and a phosphate ABC transporter (17)
have all been implicated in resistance to ?-lactams. Finally, the
selection of a nonsense mutation in a putative iron permease in
penicillin-resistant S. pneumoniae has recently been shown to de-
March 2014 Volume 58 Number 3
crease susceptibility to bactericidal antibiotics, including penicillin (18).
The identification of resistance mechanisms in S. pneumoniae
clinical isolates is complicated by the substantial polymorphisms
between field isolates (19). However, phenotypic reconstruction
by whole-genome transformation (WGT) of antibiotic-sensitive
S. pneumoniae strains of known genetic backgrounds with
genomic DNA (gDNA) derived from clinical isolates, coupled
with next-generation sequencing (NGS) of antibiotic-resistant
transformants, constitutes a powerful strategy for pinpointing determinants of resistance at the genome level (12, 20). Here, we
succeeded in reconstructing the resistance of three S. pneumoniae
penicillin-nonsusceptible clinical isolates into the penicillin-sensitive S. pneumoniae strain R6 by genome transformation. We
report the sequencing of these transformants, the extent of DNA
transformation between strains, and the characterization of the
genetic determinants defining their resistance.
MATERIALS AND METHODS
Bacterial strains, culture conditions, and MIC determination. Unless
otherwise stated, pneumococci were grown in brain heart infusion broth
(BHI; Difco) or on blood agar plates as described previously (21). Cultures were incubated for 16 to 24 h in a 5% CO2 atmosphere at 35°C.
Penicillin-resistant transformants T2-18209, T3-55938, and T5-1983
were generated in S. pneumoniae R6 (22). The MICs to penicillin were
determined with Etest strips (AB Biodisk) on Müller-Hinton agar plates
supplemented with 5% sheep blood using the manufacturer’s instructions. The MICs were further confirmed by the microdilution method
Received 20 June 2013 Returned for modification 18 August 2013
Accepted 9 December 2013
Published ahead of print 16 December 2013
Address correspondence to Marc Ouellette, Marc.Ouellette@crchul.ulaval.ca.
Copyright © 2014, American Society for Microbiology. All Rights Reserved.
doi:10.1128/AAC.01311-13
Antimicrobial Agents and Chemotherapy
p. 1397–1403
aac.asm.org
1397
Downloaded from http://aac.asm.org/ on April 24, 2019 by guest
Alterations in penicillin-binding proteins, the target enzymes for ?-lactam antibiotics, are recognized as primary penicillin resistance mechanisms in Streptococcus pneumoniae. Few studies have analyzed penicillin resistance at the genome scale, however,
and we report the sequencing of S. pneumoniae R6 transformants generated while reconstructing the penicillin resistance phenotypes from three penicillin-resistant clinical isolates by serial genome transformation. The genome sequences of the three lastlevel transformants T2-18209, T5-1983, and T3-55938 revealed that 16.2 kb, 82.7kb, and 137.2 kb of their genomes had been replaced with 5, 20, and 37 recombinant sequence segments derived from their respective parental clinical isolates, documenting
the extent of DNA transformation between strains. A role in penicillin resistance was confirmed for some of the mutations identified in the transformants. Several multiple recombination events were also found to have happened at single loci coding for
penicillin-binding proteins (PBPs) that increase resistance. Sequencing of the transformants with MICs for penicillin similar to
those of the parent clinical strains confirmed the importance of mosaic PBP2x, -2b, and -1a as a driving force in penicillin resistance. A role in resistance for mosaic PBP2a was also observed for two of the resistant clinical isolates.
Fani et al.
TABLE 1 Oligonucleotides used in this study
Gene
Sequence
FF416
FF417
FF418
FF419
FF430
FF431
FF432
FF422
FF454
FF423
FF425
FF453
FF515
FF516
PBP2X
PBP2X
PBP2X
PBP2X
PBP2B
PBP2B
PBP2B
PBP1A
PBP1A
PBP1A
PBP1A
PBP1A
spr1239
spr1239
AATGAAAATATTAGAATAGCGGAGTAAGATATGAAGTGGACAAAAAGAAT
AATGAAAATATTAGAATAGCGGAGTAAGATATGAAGTGGACAAAAAAAGT
ACAATTCCAGCACTGATGGAAATAAACATATTAGTCTCCTAAAGTTAATG
ACAATTCCAGCACTGATGGAAATAAACATATTAGTCTCCTAAAGTTAATT
ATAGGTGTTGGATAAAGCATAATTTCCTTTCTAATTCATTGGATGGTATT
ATAGGTGTTGGATAAAGCATAATTTCCTTTCTAATTCATTGGATGGTGTT
TACAATTAAGAGTAAGATTTTAAGTTAGAAATGAGACTGATTTGTATGAG
AATCACCCAGAAAAATCTGGATGATAAATGTTATGGTTGTGCTGGTTGAG
AATCACCCAGAAAAATCTGGATGATAAATGTTGTGGATTTTGTGGCGTTGG
CAAAGAACATTTATTAGGTGGTAAAACAAGATGAACAAACCAACGATTCT
CAAAGAACATTTATTAGGTGGTAAAACAAGATGAACAAACCAACTATTCT
CAAAGAACATTTATTAGGTGGTAAAACAAGATGAACAAACAAACTATTCT
ATGCAAAATCAAACACTCATGCAATACTTTG
TTAGATGGTATTGACTGCCCAGACACT
a
For amplification of pbp2x, FF416 and FF419 were used for strains CCRI-1983 and CCRI-18209 and FF417 and FF418 for strain 55938. For amplification of pbp2b, FF430 and
FF432 were used for strain CCRI-1983 and FF431 and FF432 for strains CCRI-18209 and 55938. For amplification of pbp1a, FF422 and FF425 were used for strain 55938, FF422
and FF423 for strain CCRI-18209, and FF453 and FF454 for strains CCRI-1983.
according to the Clinical and Laboratory Standards Institute (CLSI)
guidelines (23).
Transformation experiments. High-molecular-weight gDNA was extracted from the penicillin-resistant clinical isolates using the Wizard
Genomic DNA purification kit (Promega) according to the manufacturer’s instructions. The integrity of gDNA prior to whole-genome transformation was assessed by agarose gel electrophoresis. In initial experiments,
high-molecular-weight gDNA from clinical isolates CCRI-18209, 55938,
and CCRI-1983 were used to serially transform S. pneumoniae R6. The
selection of transformants was performed with increasing concentrations
of penicillin. DNA transformation was performed as previously described
(24). Briefly, pneumococci were rendered competent by culturing at 35°C
in C?Y medium at pH 6.8 (25) until the onset of exponential phase. The
cells were then concentrated 10-fold, resuspended in C?Y medium (pH
7.8) supplemented with 15% glycerol, and frozen at ?80°C. For transformation, competent cells were thawed on ice, diluted 10 times with C?Y
medium at pH 7.8, and stimulated with 2 mg/liter of competence-stimulating peptide 1 for 15 min at 35°C under a 5% CO2 atmosphere. gDNA or
PCR products were added to a final concentration of 2 mg/liter, and the
cultures were incubated for 1 h at 30°C, followed by 1 h at 35°C under a 5%
CO2 atmosphere. The cultures were then plated on tryptone agar containing Casamino Acids with the appropriate concentration of penicillin and
incubated for 48 h at 35°C under a 5% CO2 atmosphere.
Whole-genome sequencing. gDNAs were prepared from mid-logphase S. pneumoniae cultures using the Wizard Genomic DNA purification kit (Promega) according to the manufacturer’s instructions. The genomes of the T2-18209, T3-55938, and T5-1983 transformants were
sequenced using the 454 Life Sciences (Roche) GS-FLX Titanium system
(McGill University and Genome Quebec Innovation Center), which generated a genome assembly of 33? coverage, with 97% of the reads assembled into 48 and 77 large contigs. Intermediate-level transformants derived from strain CCRI-1983 were sequenced with an Illumina HiSeq1000
system (Centre de Recherche en Infectiologie, Université Laval) using a
101-nucleotide paired-end-read protocol which generated a genome assembly of 27? coverage. Intermediate-level transformants derived from
strains CCRI-18209 and 55938 were sequenced with an Illumina MiSeq
system (Centre de Recherche en Infectiologie, Université Laval) using a
250-nucleotide paired-end-read protocol. Sequence reads from each
strain were aligned to the genome of S. pneumoniae R6 (22) using the
software bwa (bwa aln, version 0.5.9) with default parameters (26). The
maximum number of mismatches was 4, the seed length was 32, and 2
mismatches were allowed within the seed. The detection of single-nucleotide polymorphisms (SNPs) was performed using samtools (version
0.1.18), bcftools (distributed with samtools), and vcfutils.pl (distributed
1398
aac.asm.org
with samtools) (27), with a minimum of three reads to call a potential
variation prior to further analysis. The circular representations of sequencing data were produced with Circos (28).
Sequence data accession numbers. The sequence data are available at
the EMBL European Nucleotide Archive (http://www.ebi.ac.uk/ena) under study accession number ERP001840 and sample accession numbers
ERS225580 and ERS179073 for S. pneumoniae T1-18209 and T2-18209,
respectively, ERS225581, ERS225582, and ERS179074 for S. pneumoniae
T1- to T3-55938, respectively, and ERS225576, ERS225577, ERS225578,
ERS225579, and ERS179072 for S. pneumoniae T1- to T5-1983, respectively. Mutations deduced from massively parallel sequencing were confirmed by PCR amplification and Sanger sequencing using the primers
listed in Table 1.
RESULTS AND DISCUSSION
In order to identify the mutations linked to the penicillin resistance phenotype of our S. pneumoniae clinical isolates, genomic
DNAs derived from CCRI-18209, CCRI-1983, and 55938 were
used for reconstructing resistance by whole-genome transformation into S. pneumoniae R6. The resulting S. pneumoniae R6 transformants were selected under penicillin pressure to favor the
transfer of DNA fragments involved in resistance. Totals of two,
three, and five rounds of transformation were required to fully
reconstruct the penicillin resistance levels of CCRI-18209, 55938,
and CCRI-1983, respectively (Table 2). The resulting last-level
TABLE 2 MICs of penicillin against transformants obtained by
introducing genomic DNA from clinical isolates CCRI-18209, CCRI1983, and 55938 into S. pneumoniae R6
Clinical isolate of
origin
Penicillin MIC
(mg/liter) of
clinical isolate
of origina
CCRI-18209
55938
CCRI-1983
4.0
4.0
8.0
Penicillin MIC (mg/liter) of
indicated S. pneumoniae R6
transformanta,b
1st
2nd
3rd
4th
5th
0.1
0.125
0.06
4.0
2.0
0.25
4.0
2.0
4.0
8.0
a
MICs were determined in triplicates; the median values are indicated. Penicillin,
penicillin G.
b
1st, 2nd, 3rd, 4th, and 5th indicate the level of transformation. For the three clinical
isolates, S. pneumoniae R6 WT (penicillin MIC, 0.023 mg/liter) was used as the
recipient strain for the transformation of genomic DNA.
Antimicrobial Agents and Chemotherapy
Downloaded from http://aac.asm.org/ on April 24, 2019 by guest
Primera
Penicillin Resistance in Streptococcus pneumoniae
March 2014 Volume 58 Number 3
formation (Fig. 1B and 2B). For clinical isolate 55938, the genome
sequences of T1- and T2-55938 also revealed a sequential acquisition of variant pbp2x and pbp2b alleles, with nucleotides 923 to
2253 of pbp2x (harboring most of the transpeptidase domain) and
nucleotides 1 to 1400 of pbp2b (harboring the dimerization domain and part of the transpeptidase domain) occurring first in
T1-55938, followed by the remainder of pbp2x and pbp2b that
were acquired concurrently in T2-55938 (Fig. 1C and 2C). This
phenomenon is different from the noncontiguous recombination
events from a single donor molecule that have recently been described in S. pneumoniae (30), given that independent rounds of
transformation were involved. S. pneumoniae clinical isolates resistant to ?-lactams were shown to acquire mosaic genes encoding
altered PBPs from recombination events between PBP alleles
within or across streptococcal species (9, 31, 32), but whether
similar distinct recombination events at single loci are involved in
the acquisition of genetic material to increase resistance remains
to be established.
The contribution of the mosaic PBP2x, -2b, and -1a to penicillin resistance was further confirmed by targeted transformation
into the penicillin-susceptible S. pneumoniae R6. PBP2x and
PBP2b are considered the primary targets of ?-lactams (9, 29, 33),
and the acquisition of low-affinity PBP2x was shown to precede
mutations in pbp2b in in vitro penicillin mutants (18). Consequently, pbp2x was first amplified from genomic DNAs derived
from T2-18209, T5-1983, and T3-55938, and the PCR products
were transformed into S. pneumoniae R6 WT. The independent
selection of transformants with a penicillin concentration of 0.06
mg/liter enabled the recovery of the transformants R62x-18209,
R62x-1983, and R62x-55938, which had 2- to 4-fold increases in their
penicillin MICs (0.06, 0.125, and 0.06 mg/liter, respectively) compared to that of S. pneumoniae R6 WT (Table 3). The targeted
sequencing of pbp2x from R62x-18209, R62x-1983, and R62x-55938 confirmed that all pbp2x mutations from T2-18209, T5-1983, and
T3-55938 were transferred. A second round of transformation
using R62x-18209, R62x-1983, and R62x-55938 as recipients and PCR
products covering the mutated pbp2b of T2-18209, T5-1983, and
T3-55938 further increased the penicillin MIC by four times, producing transformants R62x, 2b-18209, R62x, 2b-1983, and R62x, 2b-55938
with penicillin MICs of 0.25, 0.5, and 0.25 mg/liter, respectively
(Table 3). In a third round of transformation, the acquisition of a
mosaic pbp1a by R62x, 2b-18209, R62x, 2b-1983, and R62x, 2b-55938 enabled the penicillin MICs to increase to 1 to 2 mg/liter in the
transformants (Table 3).
While a role for PBP2a alterations in penicillin resistance has
only been observed sporadically (34–36), both T5-1983 and T355938 were found to harbor altered versions of pbp2a conveyed
from their respective parent clinical isolates as part of multigene
and single-gene units, respectively (Fig. 1B and C). PBP2a was
shown to have a relatively low affinity for penicillin compared
with that of other PBPs, and it has been suggested that PBP1a
mutations might therefore be selected before PBP2a in resistance
(36). While this is true for the transformants derived from clinical
isolate 55938 (Fig. 1C), pbp2a mutations from CCRI-1983 were
found to have transferred at an earlier step (T3-1983) than pbp1a
mutations (T4-1983) during the reconstruction of resistance by
WGT, a phenomenon also observed upon transformation of S.
pneumoniae with gDNA derived from the highly penicillin-resistant Streptococcus mitis B6 (37). In the case of isolate 55938, the
transformation of the R62x, 2b, 1a-55938 recipient with a PCR prod-
aac.asm.org 1399
Downloaded from http://aac.asm.org/ on April 24, 2019 by guest
transformants with penicillin MICs similar to those of the parent
clinical isolates are referred to here as T2-18209, T3-55938, and
T5-1983, respectively.
The genome sequences of the fully resistant transformants T218209, T3-55938, and T5-1983 and of all intermediate-step transformants were determined to identify the sets of mutations selectively transferred during reconstruction of penicillin resistance.
Alignment of the sequencing data to the genome of S. pneumoniae
R6 wild-type (WT) showed that the transformants T2-18209, T51983, and T3-55938 had 16.2 kb, 82.7kb, and 137.2 kb of their
genomes replaced by DNA fragments derived from their respective clinical isolates. A total of 62 recombinant sequence segments
(RSSs) ranging in size from less than 1 kb to 19.4 kb (average of 6.5
kb) were detected in the three transformants. RSSs were defined as
contiguous runs of polymorphic sites bounded by recipient-specific alleles in the S. pneumoniae R6 transformants. The T2-18209
genome sequence revealed a total of 1,660 SNPs distributed over 5
RSSs (Fig. 1A). Three of the T2-18209 RSSs included more than
one gene and are referred to as multigene RSSs. The sizes of these
three multigene RSSs varied from 2.6 kb to 9.9 kb (mean of 4.7
kb), while the other two RSSs carried unique genes (Fig. 1A) and
were less than 2.3 kb. For the T5-1983 genome, a total of 1,502
SNPs were identified as part of 20 RSSs (Fig. 1B) that ranged in size
from less than 1 kb to 19.4 kb. Ten of the T5-1983 RSSs had a mean
size of 1.2 kb (ranging from 0.3 to 2.4 kb) and were composed of
unique genes, while 10 others were found as significantly larger
(P ? 0.001) multigene RSSs with a mean size of 8.3 kb (ranging
from 2.6 to 19.4 kb). Finally, the T3-55938 genome sequence revealed 1,812 donor SNPs clustered into 37 RSSs, of which 23 conveyed multiple genes (Fig. 1C). With a mean size of 6 kb (ranging
from 2.4 to 15.5 kb), these multigene RSSs were again significantly
larger (P ? 0.001) than the other RSSs, which had a mean size of
1.4 kb (ranging from 0.2 to 2.7 kb).
S. pneumoniae contains six PBPs, but only variants of PBP2x,
PBP2b, and PBP1a are frequently described in resistant clinical
isolates. Not surprisingly, the three S. pneumoniae last-level transformants contained mosaic alleles of these genes. The acquisition
of low-affinity PBP2x and PBP2b variants was shown to be a prerequisite for PBP1a variants to confer high-level resistance to
?-lactams (3, 4, 29), and mutations within pbp1a were indeed
transferred after pbp2x and pbp2b mutations, as demonstrated by
the sequencing of intermediate-level transformants (Fig. 1). Mosaic pbp2x and pbp2b were acquired by T2-18209, T5-1983, and
T3-55938 as part of multigene RSSs (Fig. 1). Mosaic pbp1a was
also acquired as part of multigene RSSs by T2-18209 and T5-1983
but appeared in T3-55938 as part of a single gene transfer event
(Fig. 1). Interestingly, our stepwise whole-genome transformation and sequencing scheme revealed that the acquisition of mosaic alleles of pbp2x and/or pbp2b involved multiple recombination events that occurred at distin…
Purchase answer to see full
attachment